lelgenio@lemmy.ml to Memes@lemmy.ml · 1 year agoAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimagemessage-square9fedilinkarrow-up1450arrow-down126file-text
arrow-up1424arrow-down1imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mllelgenio@lemmy.ml to Memes@lemmy.ml · 1 year agomessage-square9fedilinkfile-text
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-squareKowowow@lemmy.calinkfedilinkEnglisharrow-up4·1 year agoya I’ve kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you
ya I’ve kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you